Archives

  • 2022-05
  • 2022-04
  • 2021-03
  • 2020-08
  • 2020-07
  • 2020-03
  • 2019-11
  • 2019-10
  • 2019-09
  • 2019-08
  • 2019-07
  • br Flow cytometric analysis br For cell apoptosis analysis

    2022-05-04


    2.6. Flow cytometric analysis
    For cell apoptosis analysis, A549 cells were collected after trypsi-nization, and then washed in PBS. UNC1999 A combination of Annexin V-FITC and propidium iodide (PI) stain was used (BD Pharmingen, CA, USA). The BD FACSVerse was applied to analyze the apoptosis of the samples via FACS Suite. For cell cycle assay, the harvested cells were fixed with precooled 70% ethanol overnight at 4 °C, and then the cellular DNA was stained with PI solution (50 μg/mL) for 30 min at room temperature. The cell cycle of the PI-stained cells was analyzed using BD FACSVerse.
    2.7. Transwell invasion assay and wound healing assay
    A Transwell assay with inserts Matrigel coated (BD Biosciences, CA, USA) was used to perform Transwell experiments. DMEM (500 μL) containing 10% FBS was added to the lower chamber, and 1 × 105 cells in serum-free DMEM were seeded into the upper chamber. After 24 h’ incubation, the migrated cells were fixed with pre-cooled methanol and stained with crystal violet. The number of invaded cells was counted under a microscope. For wound healing assay, the cells were seeded in a 6-well plate for 24 h. A straight line was drawn across the monolayer with a 200 μL tip, and the line was photographed at beginning of the time point. Afterward, DMEM with 2% FBS was added to the well. The photos were taken at the indicated time point.
    2.8. Colony forming assay
    For colony formation assay, 200 cells were seeded in a 60 mm plate and cultured in DMEM containing 10% FBS. After the treatment with CAP and iron oxide-based MNPs, the cell colonies were fixed with 4% paraformaldehyde for 5 min and stained with crystal violet for 2 min. The number of colonies was counted under an inverted microscope.
    2.9. Western blot analysis
    Cell lysates were prepared, and protein concentration was detected by Bio-Rad Protein Assay. Cell lysates were separated by SDS-PAGE gels, and the separated proteins were transferred into polyvinylidene fluoride membranes. These membranes were initially incubated with primary UNC1999 including E-cadherin, vimentin, pAKT, AKT, and ERK1/2 (Cell Signaling Technology, MA, USA) overnight at 4 °C, and then incubated with appropriate secondary antibodies conjugated with horseradish peroxidase (Maxim, Fuzhou, China) at a dilution ratio of 1:2500 at 37 °C for 1 h. The phosphorylation sites of pAKT is Ser437, and the phosphorylation sites of pAKT of pERK1/2 is p44/42,
    Fig. 2. Characterization of iron oxide-based MNPs: (a) Iron oxide-based MNPs nanocrystals determined by TEM, (b) The hydrodynamic size of MNPs displayed using DLS, (c) the Zeta potential of iron oxide-based MNPs is -31.3 ± 5.46 mV, (d) magnetic hysteresis loop of Iron oxide-based MNPs recorded at 300 K, and the saturation magnetization was about 50 emu/g, (e) Iron oxide-based MNPs phagocytosed by A549 cells was stained with Prussian blue.
    Fig. 3. Cytotoxic effect of iron oxide-based MNPs and CAP on A549 cells in vitro (48 h): (a) MTT assay for A549 cells after CAP treatment, (b) decreased viability of A549 cells after iron oxide-based MNPs treatment, (c) synergistic effects of iron oxide-based MNPs and CAP on cell viability of A549 cells.
    respectively. Immunoreactive bands were visualized using ECL. Band intensities were quantified with Gel-Pro Analyzer.
    SYBR Green-based quantitative qRT-PCR was performed to assess 
    the expression of mRNA in A549 cells by using a 7500 Real-time PCR System (Applied Biosystems, CA, USA). Total RNA was extracted from lung cancer cells by utilizing TRIzol (Ambion, TX, USA). The PCR primer sequences were as follows: primers for EGFR, forward: 5′-tgtttgggacctccggtcag-3′ and reverse: 5′-ggcaggtcttgacgcagtgg-3′; E-cad-herin, forward:5′-accattaacaggaacacagg -3′ and reverse: 5′-
    Fig. 4. The intracellular ROS levels activated by CAP and iron oxide-based MNPs: (a) the intracellular ROS stained with DCFH-DA in A549 cells after treated by CAP or iron oxide-based MNPs individually or in combination measured by fluorescence microscopic, and (b) Flow cytometry was used to quantify detect the ROS intensity.
    cagtcactttcagtgtggtg -3′; vimentin, forward:5′- gacctctacgaggaggagat-3′ and reverse: 5′-ttgtcaacatcctgtctgaa-3′; GAPDH forward 5′-cta-caatgagctgcgtgtgg-3′ and reverse 5′-aaggaaggctggaagagtgc-3′.
    2.11. Immunohistochemical assay
    Immunohistochemistry was performed on NSCLC tissue slides with a primary antibody (Cell Signaling Technology, MA, USA) and a sec-ondary antibody conjugated with horseradish peroxidase (Maxim, Fuzhou, China). The color reaction was performed with 3,3-diamino-benzidine. The staining intensities of the samples were analyzed in terms of integrated optical density and classified by two pathologists. A staining index (SI) score > mIOD indicated tumors with high expres-sion, and an SI score ≤mIOD corresponded to low expression.